View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15877_high_11 (Length: 221)
Name: NF15877_high_11
Description: NF15877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15877_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 24 - 195
Target Start/End: Original strand, 52889808 - 52889977
Alignment:
| Q |
24 |
atgttaagattttgtcttgggtcaaaggtatgggtgatgtgata-tttttctcactttctagtttctagtagca----tatgttataatttaggtgacgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52889808 |
atgttaagattttgtcttgggtcaaaggtatgggtgatgtgatattttttctcactttctagtttctagtagcataagtatgttataatttaggtgacgt |
52889907 |
T |
|
| Q |
119 |
tgtgccattatttgaaatgccaaataaataaataatatcattgtcgtgacacatttatttaatagatagtgtgtgaa |
195 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
52889908 |
tgtggcattatttg-------aaataaataaataatatcatagtcgtgacacatttatttaatagatagtgtgtgaa |
52889977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University