View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15877_low_12 (Length: 207)

Name: NF15877_low_12
Description: NF15877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15877_low_12
NF15877_low_12
[»] chr7 (1 HSPs)
chr7 (6-180)||(11411987-11412161)
[»] chr2 (1 HSPs)
chr2 (12-169)||(38524375-38524538)


Alignment Details
Target: chr7 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 6 - 180
Target Start/End: Complemental strand, 11412161 - 11411987
Alignment:
6 agtgagaagaataaagataaagaagtgattgatattgaagcttcagctgaaagagaagaagctaacaggaaaaagcaggaaaggatacttgatcaagaag 105  Q
    ||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||    
11412161 agtgataagaataaagataaagaagtgattgatatttaagcttcagctgaaagagaggaagctaacaggaaaaagcaggaaaggctacttgatcaagaag 11412062  T
106 gaagttccagtaaaacaaatgatgtagatttgttgaaggagcaggatatggtactagagcaggaattgaatgaac 180  Q
    ||||||||||||||||||||  || |||| |||||||||| ||||||||||||||||||||||||||||||||||    
11412061 gaagttccagtaaaacaaatcctgcagatctgttgaaggatcaggatatggtactagagcaggaattgaatgaac 11411987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 12 - 169
Target Start/End: Original strand, 38524375 - 38524538
Alignment:
12 aagaataaagataaagaagtgattgatattgaagcttcagctg--aaagagaag----aagctaacaggaaaaagcaggaaaggatacttgatcaagaag 105  Q
    ||||||||||||||| ||||||||||| |||||||||||| ||  || || |||    ||||||||| |||  |||| | || | |||||||||||||||    
38524375 aagaataaagataaataagtgattgatcttgaagcttcagatggaaaggaaaaggagaaagctaacaagaatgagcaaggaaagttacttgatcaagaag 38524474  T
106 gaagttccagtaaaacaaatgatgtagatttgttgaaggagcaggatatggtactagagcagga 169  Q
     ||| |||| |||| |||||   | || | |||||||||||||||||| | |||||||||||||    
38524475 caagctccaataaatcaaatccagcagctctgttgaaggagcaggataagttactagagcagga 38524538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University