View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15877_low_8 (Length: 291)
Name: NF15877_low_8
Description: NF15877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15877_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 1 - 281
Target Start/End: Original strand, 23344451 - 23344731
Alignment:
| Q |
1 |
atatgaataatcccatgatgatgtagaaggcattataggacaagataaattattactattctcttcactagttccatcaaaatcaggttgaagaacattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23344451 |
atatgaataatcccatgatgatgtagaaggcattataggacaagataaattattgctattctcttcactagttccatcaaaatcaggttgaagaacattg |
23344550 |
T |
 |
| Q |
101 |
atgtcatcttcagacatagcaatatctttccatatatcatccattgagtacccttgttcaatttcttgtacttggtaattttcttcttcagactctttgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
23344551 |
atgtcatcttcagacatagcaatatctttccatatatcatccattgagtacccttgttcaatttcttggacttggtaattttcttcttcagactctttgt |
23344650 |
T |
 |
| Q |
201 |
tggaagcatgtgaatccacaccatggttactatttgagaaatgtgaggattgacaactagaagattgatcaggtgatgatg |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23344651 |
tggaagcatgtgaatccacaccatggttactatttgagaaatgtgaggattgacaactagaagattgatcaggtgatgatg |
23344731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University