View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15877_low_9 (Length: 285)
Name: NF15877_low_9
Description: NF15877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15877_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 14 - 267
Target Start/End: Complemental strand, 23344474 - 23344220
Alignment:
| Q |
14 |
acatcatcatgggattattcatatttagatccattgtgggtgatggatgaagaagaaagcaagatgttattccctcctattggtgaacaatatttttcct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
23344474 |
acatcatcatgggattattcatatttagatccattgtgggtgatggatgaagaagaaagcaagatgttattccctcctattggtgaccaatatttttcct |
23344375 |
T |
|
| Q |
114 |
tctatgatcaacaagggaacacatttctaactggttaatcaagattattc-nnnnnnnncttcttcaatattttgttcatatgtgtgccatctgtcataa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
23344374 |
tctatgatcaacaagggaacacatttctaactggttaatcaagattattctttttttttcttcttcaatattttgttcatatgtgtaccatctgtcataa |
23344275 |
T |
|
| Q |
213 |
gatagcctaattaacatgtatatagcatagtatatgtctttctgaaagggatttg |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23344274 |
gatagcctaattaacatgtatatagcatagtatatgtctttctgaaagggatttg |
23344220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University