View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15878_high_15 (Length: 277)
Name: NF15878_high_15
Description: NF15878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15878_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 294191 - 293929
Alignment:
| Q |
1 |
agaaagtctatttgcagctgactaattgaatatgcaggttaagattggaattcaaggggctgaagaatttggtgaatttgaggaatggttcaattaccgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
294191 |
agaaagtctatttgcagctgactaattgaatatgcaggttaagattggaattcaaggggctgaagaatttggtgaatttgaggaatggttcaattaccgg |
294092 |
T |
 |
| Q |
101 |
ctatctagagcagcacctgaaacctgtgctgacttccttggaagttttgtggctgataaaacaaactcacagttcacaaaaggtggaaaatggcttgttt |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
294091 |
ctatctagagcagcacctgaaacatgtgctgacttccttggaagttttgtggctgataaaacaaactcacagttcacaaaaggtggaaaatggcttgttt |
293992 |
T |
 |
| Q |
201 |
ggaaatttgaggtgccttggctcatatttcgatcgtattatttaacattaatagccttaaatt |
263 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
293991 |
ggaaatttgaggtgccttggctcatattttgatcgtattatttaacattaatagccttaaatt |
293929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 92; Significance: 9e-45; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 32 - 215
Target Start/End: Original strand, 27491727 - 27491910
Alignment:
| Q |
32 |
atgcaggttaagattggaattcaaggggctgaagaatttggtgaatttgaggaatggttcaattaccggctatctagagcagcacctgaaacctgtgctg |
131 |
Q |
| |
|
|||||||| ||| |||||||| |||| ||| ||||||||||||| | ||| || ||||||||||| | || || |||||||| |||||||| ||||| |
|
|
| T |
27491727 |
atgcaggtgaaggttggaattgaaggagctaaagaatttggtgattatgaagagtggttcaattatagactctcaagagcagctcctgaaacatgtgcca |
27491826 |
T |
 |
| Q |
132 |
acttccttggaagttttgtggctgataaaacaaactcacagttcacaaaaggtggaaaatggcttgtttggaaatttgaggtgc |
215 |
Q |
| |
|
| ||||||||||||||||| ||||||||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27491827 |
agttccttggaagttttgtagctgataaaaccaattcacaattcacaaaaggtggaaaatggcttgtttggaaatttgaggtgc |
27491910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University