View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15878_low_21 (Length: 261)
Name: NF15878_low_21
Description: NF15878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15878_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 17 - 241
Target Start/End: Complemental strand, 44752153 - 44751928
Alignment:
| Q |
17 |
attatgaacatgtcttcaatgagtaactatacgtatatacatgagaagcc-aatgaatctttttcccctgttcatatttggtcaattatttaaattaatt |
115 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44752153 |
attatgaacatgtcttcaatcagtaactatacgtatatacatgagaagcctaatgaatctttttcccctgttcatatttggtcaattatttaaattaatt |
44752054 |
T |
|
| Q |
116 |
taaacttgcatgtgctgggtaagtatcatgttttccatataccttttgttttgtgtgtggcacatgcataggtcaactctcatcaaatgtgtatattaat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44752053 |
taaacttgcatgtgctgggtaagtatcatgttttccatatatcatttgttttgtgtgtggcacatgcataggtcaactctcatcaaatgtgtatattaat |
44751954 |
T |
|
| Q |
216 |
cgaaagtaaaccctttatagtagtat |
241 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
44751953 |
ggaaagtaaaccctttatagtagtat |
44751928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University