View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15878_low_23 (Length: 259)
Name: NF15878_low_23
Description: NF15878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15878_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 7222390 - 7222152
Alignment:
| Q |
1 |
aggaccatcgctcggatgaacgaagaagggaggggtttgatgcagagaagggtcaaccgtaggaacatgagccaatctaggtggcattgcgatgaacgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7222390 |
aggaccatcgctcggatgaacgaagaagggtgtggtttgatgcagagaagggtcaaccgtaggaacatgagccaatctaggtggcattgcgatgaacgaa |
7222291 |
T |
 |
| Q |
101 |
ggcaaactgcgga---tcgctacacaacgaatgataccatgttaagatgaaaaaccacatatgagaataagaagaaggagaagattgaataaggaaaagt |
197 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7222290 |
ggcaaactgcggaggatcgctacacaacgaatgataccatgttaagatgaaaaagcacatatgagaataagaagaaggagaagattgaataaggaaaagt |
7222191 |
T |
 |
| Q |
198 |
gtgattctcatagattgaattgtgagcttacaactaatt |
236 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7222190 |
gggattctcatagattgaattgtgagcttacaactaatt |
7222152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University