View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15878_low_29 (Length: 233)
Name: NF15878_low_29
Description: NF15878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15878_low_29 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 4 - 233
Target Start/End: Complemental strand, 8226745 - 8226516
Alignment:
| Q |
4 |
caaggtggagaaaaccgcaacactcaatttaattgggttgttagttaaaaacagtagtttacaattaaaaaacaaattgttatttcaatgctgcaagagt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8226745 |
caaggtggagaaaaccgcaacactcaatttaattgggttgttagttaaaaacagtagtttacaattaaaaaacaaattgttattacaatgctgcaagagt |
8226646 |
T |
 |
| Q |
104 |
tctagtctaaaaggtttagctcagcttgtttcgaacccggcaccttacagctgtcagttttgggtgatgcttgccacttcgtctagagacaaaatagaaa |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8226645 |
tctagtctaaaaggtttagctcagcttgtttcgaacccggcaccttatagctgtcagttttgggtgatgcttgccacttcgtctagagacaaaatagaaa |
8226546 |
T |
 |
| Q |
204 |
atgcattgcagcagcagatcgagtctatca |
233 |
Q |
| |
|
||||||||||||||| | |||||||||||| |
|
|
| T |
8226545 |
atgcattgcagcagcgggtcgagtctatca |
8226516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University