View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15878_low_30 (Length: 230)
Name: NF15878_low_30
Description: NF15878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15878_low_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 20 - 214
Target Start/End: Original strand, 10099082 - 10099276
Alignment:
| Q |
20 |
gatgagaggacaaatatgtggtgagattaaggacaagaaaaactctcacctgaggagagtttctactcaatattagaagaacgaaaagatgatgttctac |
119 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10099082 |
gatgagaggacaaatatgtggtgatattaaggacaagaaaaactctcacctgaggagagtttctactcaatattagaagaacgaaaagatgatgttctac |
10099181 |
T |
|
| Q |
120 |
aactacagatttatgcgttatctaagtgaaaaatttaatttaatttagagtataaattaaacaatatcaaatgttgatgaataaatacgattcat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10099182 |
aactacagatttatgcgttatctaagtgaaaaatttaatttaatttagagtataaattaaacaatatcaaatgttgatgaataaatacgattcat |
10099276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University