View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15878_low_33 (Length: 217)
Name: NF15878_low_33
Description: NF15878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15878_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 20 - 206
Target Start/End: Complemental strand, 3007886 - 3007700
Alignment:
| Q |
20 |
aagccagccaaatgaaagcaatgtaccatatgtagtgcagctacagccccctattcaaaatacatttggtactttagattttatttaaataatcgaaaaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3007886 |
aagccagccaaatgaaagcaatgtaccatatgtagtgcagctacagccccctattcaaaatacatttggtactttagattttatttaaataatcgaaaaa |
3007787 |
T |
 |
| Q |
120 |
tagttttgtaaacagcggatattttgtaataatatgtaacaattttatccggtccattaattaggctcgttaggttagaataatcta |
206 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3007786 |
tagttttgtaaacagcgtatattttgtaataatatgtaacaattttatccggtccattaattaggctcgttaggttagaataatcta |
3007700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University