View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15879_high_5 (Length: 222)
Name: NF15879_high_5
Description: NF15879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15879_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 6305531 - 6305730
Alignment:
| Q |
1 |
cctaacacgtgaggtatttttaaaacctggggtaggaaaagaatctctccaaacacagtnnnnnnn----ctgttgtattttatgaagttatataccaat |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
6305531 |
cctaacacgtgaggtatttttaaaacctggggtaggaaaagaatctctccaaacacagtaaaaaaaaaaactgttgtattttatgaagttata--ccaat |
6305628 |
T |
 |
| Q |
97 |
gtacaaaccagcctaccactctacctctagagtgatgatggattcagagagcatatgcaaattggcagcatcttatgcagcatacgtaccttcatacaca |
196 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
6305629 |
gtacaaaccagtctaccactctacctctagagtgatgatggattcagagagcatatgcaaattggcagcatcttatgcagcatacgtaccttcataaaca |
6305728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University