View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15879_high_7 (Length: 214)

Name: NF15879_high_7
Description: NF15879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15879_high_7
NF15879_high_7
[»] chr5 (1 HSPs)
chr5 (87-201)||(986360-986474)


Alignment Details
Target: chr5 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 87 - 201
Target Start/End: Complemental strand, 986474 - 986360
Alignment:
87 ccaattatcttcctttctgtttacaaccattctctcctccgcaggaaagaatggtaacggttaaactgtaaaaactggcaaaaccataaaataccgattt 186  Q
    |||||||||||||||||||||||||||||| || |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
986474 ccaattatcttcctttctgtttacaaccatgctgtcctccgcaggaaagaatggcaacggttaaactgtaaaaactggcaaaaccataaaataccgattt 986375  T
187 ccagtcttctgtgct 201  Q
    |||||||||||||||    
986374 ccagtcttctgtgct 986360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University