View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15879_low_11 (Length: 214)
Name: NF15879_low_11
Description: NF15879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15879_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 87 - 201
Target Start/End: Complemental strand, 986474 - 986360
Alignment:
| Q |
87 |
ccaattatcttcctttctgtttacaaccattctctcctccgcaggaaagaatggtaacggttaaactgtaaaaactggcaaaaccataaaataccgattt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
986474 |
ccaattatcttcctttctgtttacaaccatgctgtcctccgcaggaaagaatggcaacggttaaactgtaaaaactggcaaaaccataaaataccgattt |
986375 |
T |
 |
| Q |
187 |
ccagtcttctgtgct |
201 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
986374 |
ccagtcttctgtgct |
986360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University