View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15879_low_3 (Length: 371)
Name: NF15879_low_3
Description: NF15879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15879_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 26 - 287
Target Start/End: Complemental strand, 6306028 - 6305758
Alignment:
| Q |
26 |
gttaaggaattgttaggggtaaagaggacagtaggatattcgaatttggggtcaaatatccggctacagtgtaaagagactctgaaaatcaaatgtatgg |
125 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6306028 |
gttagggaattgttaggggtaaagaggacagttggatattcgaatttggggtcaaatatccggctacagtgtaaagagactctgaaaatcaaatgtatgg |
6305929 |
T |
|
| Q |
126 |
atgatcacggacagct----tcatgtattcacatgtcaatataagctttcgaatc----taaaagg---catcattaatccaatacttcatgtattcaca |
214 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6305928 |
atgatcacggacagcttcattcatgtattcacatgtcaatataagctttcgaatctaaataaaaggcatcatcattaatccaatacttcatgtattcaca |
6305829 |
T |
|
| Q |
215 |
tgccttggactatataattaagttccattgtaagcgtaaatagtaacacttccaggcattccttatcttttta |
287 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6305828 |
tgccttggac--tataattaagttccattgtaagcgtaaatagtaacacgtccaggcattccttatcttttta |
6305758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University