View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15879_low_5 (Length: 319)
Name: NF15879_low_5
Description: NF15879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15879_low_5 |
 |  |
|
| [»] chr6 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 39 - 319
Target Start/End: Original strand, 31206145 - 31206420
Alignment:
| Q |
39 |
ttttggattgctcctaaaattcacccaaaaatctgtaaaatataaacaaatattagttgtctttgcattctaattaaatgtgttataagtctcagagatt |
138 |
Q |
| |
|
|||| ||||||||||||| || ||||||||||| | ||||||||| |||||||||||||| |||||||||||| |||||||| ||||| | |||||| |
|
|
| T |
31206145 |
tttttgattgctcctaaagtttacccaaaaatcag-aaaatataatcaaatattagttgtttttgcattctaa----atgtgttacaagtccctgagatt |
31206239 |
T |
 |
| Q |
139 |
cgattccacctcttgatggaggaaaagaagttgttttcgagagaattttctcaaattgttttaggatgtggatatttgaacccgtgatgtgtgagattcc |
238 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31206240 |
cgattccacctctcgatggaggaaaaaaagttgttttcgagagaattttctcaaattgttttaggatgtggatatttgaacccgggatgtgtgagattcc |
31206339 |
T |
 |
| Q |
239 |
aacaagggttgtatggcataaagaaaataagaaccaaattgcaaacattattatacttacatttaagcacttgccacaagc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31206340 |
aacaagggttgtatggcataaagaaaataagaaccaaattgcaaacattattatacttacatttaagcacttgccacaagc |
31206420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 16 - 63
Target Start/End: Original strand, 31196144 - 31196191
Alignment:
| Q |
16 |
taaatttcaaatattagttgttattttggattgctcctaaaattcacc |
63 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
31196144 |
taaagttcaaatattagttgtttttttggattgctcctaaagttcacc |
31196191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 16 - 63
Target Start/End: Original strand, 31174735 - 31174782
Alignment:
| Q |
16 |
taaatttcaaatattagttgttattttggattgctcctaaaattcacc |
63 |
Q |
| |
|
|||| ||||||||||||||||| | |||||||||||||||| |||||| |
|
|
| T |
31174735 |
taaagttcaaatattagttgttttcttggattgctcctaaagttcacc |
31174782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University