View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15879_low_8 (Length: 243)
Name: NF15879_low_8
Description: NF15879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15879_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 20 - 225
Target Start/End: Complemental strand, 37249471 - 37249267
Alignment:
| Q |
20 |
ttgacatgtttcttactcacttaaaaaactagtgtaaaataagttgctgcctttgaagatgtttgatttctatgcatgagcttgaatgatgtatatgata |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37249471 |
ttgacatgtttcttactcacttaaaaaactagtgtaaaataagttgctgcctttaaagatgtttgatttctatgcatgagcttgaatgatgtagatgata |
37249372 |
T |
 |
| Q |
120 |
aaaacaaaggagtctttgatgtttcttgatgattgacaaatatcaagagagtatgattatgctaaagacttatgctctttctccttgttgaacactttat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
37249371 |
aaaacaaaggagtctttgatgtttcttgatgattgacaaatatcaagagagtatgattatgctcaagacttatgctctttgtccttgttgaaca-tttat |
37249273 |
T |
 |
| Q |
220 |
agatga |
225 |
Q |
| |
|
|||||| |
|
|
| T |
37249272 |
agatga |
37249267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University