View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15880_high_5 (Length: 246)
Name: NF15880_high_5
Description: NF15880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15880_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 20 - 229
Target Start/End: Complemental strand, 26435596 - 26435387
Alignment:
| Q |
20 |
tttaaaagcttttaatattttggaaaataagatgatcctgtgttgtattttgtttttcaatttcatttcagttgatttatataagatacaaccattttga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26435596 |
tttaaaagcttttaatattttggaaaataagatgatcctgtgttgtattttgtttttcaatttcatttcagttgatttatataagatacaaccattttga |
26435497 |
T |
 |
| Q |
120 |
tttagctgatcttacttcaggtgattgacataatccatgtttggctccatatttgtcagttaatcttcaattacctaactactcggtaactatttgatca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26435496 |
tttagctgatcttacttcaggtgattgacataatccatgtttggctccatatttgtcagttaatcttcaattacctaactactcggtaactatttgatca |
26435397 |
T |
 |
| Q |
220 |
taactagatt |
229 |
Q |
| |
|
|||||||||| |
|
|
| T |
26435396 |
taactagatt |
26435387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University