View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15881_high_1 (Length: 356)
Name: NF15881_high_1
Description: NF15881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15881_high_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 97 - 342
Target Start/End: Complemental strand, 52976563 - 52976321
Alignment:
| Q |
97 |
gctgaaatctaaaaatattctaattaggttctctcaactcacatgaagaggcataaagtggagtgcagccaaggatgacttgccggcaatatatctaatt |
196 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52976563 |
gctgaaatctaaa--tattctaattaggttctctcaactcacatgaagaggcataaagtggagtgcagccaaggatgacttgccggtaatatatctaatt |
52976466 |
T |
 |
| Q |
197 |
cctttggtctcttccggcaagttgttcttggctacattttgcttttttcttctcctgtgatgctttgaggactcatcttcagtttgcagtctttagaatt |
296 |
Q |
| |
|
|||| ||| ||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52976465 |
cctt-ggtttcttccggcaagttgttcttgactacattttgcttttttcttctcatgtgatgctttgaggactcttcttcagtttgcagtctttagaatt |
52976367 |
T |
 |
| Q |
297 |
ttatttacaaggaaaacgatgcctatatgttatcacgaaaaaggtg |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52976366 |
ttatttacaaggaaaacgatgcctatatgttatcacgaaaaaggtg |
52976321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 137 - 183
Target Start/End: Original strand, 34472301 - 34472347
Alignment:
| Q |
137 |
acatgaagaggcataaagtggagtgcagccaaggatgacttgccggc |
183 |
Q |
| |
|
||||||||||||| | |||| ||| |||||||||||||||||||||| |
|
|
| T |
34472301 |
acatgaagaggcagagagtgtagtacagccaaggatgacttgccggc |
34472347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 211 - 255
Target Start/End: Original strand, 16049990 - 16050034
Alignment:
| Q |
211 |
cggcaagttgttcttggctacattttgcttttttcttctcctgtg |
255 |
Q |
| |
|
||||||||| |||||||||||||| ||||| ||||||||||||| |
|
|
| T |
16049990 |
cggcaagttcctcttggctacatttcgctttcttcttctcctgtg |
16050034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University