View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15881_low_2 (Length: 299)
Name: NF15881_low_2
Description: NF15881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15881_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 10 - 284
Target Start/End: Complemental strand, 423284 - 423010
Alignment:
| Q |
10 |
catcatcatcattataattatttgttgtaatcaattcccttttatattactatggacttgaatttgattgctctgcgtttcctttttccgtaggtggctc |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
423284 |
catcatcatcattataattatttgttgtaatcaattcccatttatattactatggacttgaatttgattgctctgcgtttcctttttccgtaggtggctc |
423185 |
T |
 |
| Q |
110 |
ctcggaataccattggagaggtccctttgaagtggtatgaggatgaaccccatattggatatgacatcaaggggaagaagattaagaagaaagaaaggga |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
423184 |
ctcggaataccattggagaggtccctttgaagtggtatgaggatgaaccccatattggatatgacatcaaggggaagaagattaagaagaaagaaaggga |
423085 |
T |
 |
| Q |
210 |
agacaaattgggttcctttcttgcaaatgttgacgattctaagaattggttagtttcatatatctatattaactt |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
423084 |
agacaaattgggttcctttcttgcaaatgttgatgattctaagaattggttagtttcatatatctatattaactt |
423010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University