View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15882_high_10 (Length: 250)
Name: NF15882_high_10
Description: NF15882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15882_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 21 - 235
Target Start/End: Complemental strand, 31013283 - 31013068
Alignment:
| Q |
21 |
tttctctctcatttgaggttgattatgaatcagtgtgatgaggttgcaaaggagc-tatatagtgttgattttgcctctgaattgtggcagagaattctc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
31013283 |
tttctctctcatttgaggttgattatgaatcagtgtgatgaggttgcaaaggaggatacatagtgttgtttttgtctctgaattgtggcagagaattctc |
31013184 |
T |
 |
| Q |
120 |
tttacttggttaaggctaaacttaacaagaaggggatgatgaggaccagcaagtggagaataagaaggaaaattcaactcatgatttatggaagtaaaag |
219 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31013183 |
tttacttggttaacgctaaacttaacaagaaggggatgatgaggaccactaaggggagaataagaaggaaaattcaactcatgatttatggaagtaaaag |
31013084 |
T |
 |
| Q |
220 |
tatttttctacctttg |
235 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
31013083 |
tatttttctacctttg |
31013068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University