View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15882_high_8 (Length: 302)
Name: NF15882_high_8
Description: NF15882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15882_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 146 - 270
Target Start/End: Original strand, 38371208 - 38371332
Alignment:
| Q |
146 |
gagtgagagcagtgaaaatgaggattgttgtttgtttacaacaaccgcggtttcatctttctttctacttccttcccgctcgctatagggaattttcggg |
245 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38371208 |
gagtgagagcagtgaaaacgaggattgttgtttgtttacaacaaccgcggtttcatctttctttctacttccttcccgctcgctatagggaattctcggg |
38371307 |
T |
|
| Q |
246 |
gcgcgagattatagggaatgacagg |
270 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
38371308 |
gcgcgagattatagggaatgacagg |
38371332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 17 - 55
Target Start/End: Original strand, 38371069 - 38371107
Alignment:
| Q |
17 |
taataaactatcattcaaataccaacacaacatagattg |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38371069 |
taataaactatcattcaaataccaacacaacatagattg |
38371107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 117 - 154
Target Start/End: Original strand, 38371167 - 38371204
Alignment:
| Q |
117 |
gtgaaaacaaggaaagggaacctgggtgtgagtgagag |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38371167 |
gtgaaaacaaggaaagggaacctgggtgtgagtgagag |
38371204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University