View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15882_high_8 (Length: 302)

Name: NF15882_high_8
Description: NF15882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15882_high_8
NF15882_high_8
[»] chr8 (3 HSPs)
chr8 (146-270)||(38371208-38371332)
chr8 (17-55)||(38371069-38371107)
chr8 (117-154)||(38371167-38371204)


Alignment Details
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 146 - 270
Target Start/End: Original strand, 38371208 - 38371332
Alignment:
146 gagtgagagcagtgaaaatgaggattgttgtttgtttacaacaaccgcggtttcatctttctttctacttccttcccgctcgctatagggaattttcggg 245  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
38371208 gagtgagagcagtgaaaacgaggattgttgtttgtttacaacaaccgcggtttcatctttctttctacttccttcccgctcgctatagggaattctcggg 38371307  T
246 gcgcgagattatagggaatgacagg 270  Q
    |||||||||||||||||||||||||    
38371308 gcgcgagattatagggaatgacagg 38371332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 17 - 55
Target Start/End: Original strand, 38371069 - 38371107
Alignment:
17 taataaactatcattcaaataccaacacaacatagattg 55  Q
    |||||||||||||||||||||||||||||||||||||||    
38371069 taataaactatcattcaaataccaacacaacatagattg 38371107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 117 - 154
Target Start/End: Original strand, 38371167 - 38371204
Alignment:
117 gtgaaaacaaggaaagggaacctgggtgtgagtgagag 154  Q
    ||||||||||||||||||||||||||||||||||||||    
38371167 gtgaaaacaaggaaagggaacctgggtgtgagtgagag 38371204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University