View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15882_low_11 (Length: 331)
Name: NF15882_low_11
Description: NF15882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15882_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 29 - 145
Target Start/End: Original strand, 32069929 - 32070045
Alignment:
| Q |
29 |
ttgtatcaaactatccttgcatatagaaattgtatttagttctttgatcccatacactttaactaatttttggggagatctccagacttttatctacaac |
128 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
32069929 |
ttgtatcaaactatccttgcgtatagaaattgtatttagttctttgatcccatacactttaactaatttttagggagatctcgagacttttatctacaac |
32070028 |
T |
 |
| Q |
129 |
tttcacatcatcgtcaa |
145 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
32070029 |
tttcacatcatcgtcaa |
32070045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 210 - 320
Target Start/End: Original strand, 32070110 - 32070220
Alignment:
| Q |
210 |
attatttccaattttcttatcctctccaggtatctcatcatcctaaacaggcttaagttcattatacttacacattctagcaaaatgtttaaactctagg |
309 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32070110 |
attatttctaattttcttatcctctcccggtatctcatcatcctaaacacgcttaagttcattatacttacacattctagcaaaatgtttaaactctaga |
32070209 |
T |
 |
| Q |
310 |
cctatgcttct |
320 |
Q |
| |
|
|||||||||| |
|
|
| T |
32070210 |
tctatgcttct |
32070220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University