View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15882_low_16 (Length: 245)
Name: NF15882_low_16
Description: NF15882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15882_low_16 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 144 - 218
Target Start/End: Original strand, 22422587 - 22422661
Alignment:
| Q |
144 |
tgatcaagttgtattcatatagttaatttgatataagaattattgtaatatcttctttatgagagttatatatat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22422587 |
tgatcaagttgtattcatatagttaatttgatataagaattattgtaatatcttctttatgagagttatatatat |
22422661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 65 - 121
Target Start/End: Original strand, 27174388 - 27174443
Alignment:
| Q |
65 |
attaatagagatagaaaaaacctcattggagtaactttcaaccttggtccttcaatc |
121 |
Q |
| |
|
||||| ||||||||||||||| |||||| ||||||||||||||| |||||||||||| |
|
|
| T |
27174388 |
attaacagagatagaaaaaac-tcattgcagtaactttcaacctcggtccttcaatc |
27174443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University