View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15882_low_17 (Length: 243)
Name: NF15882_low_17
Description: NF15882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15882_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 12 - 225
Target Start/End: Complemental strand, 10864747 - 10864534
Alignment:
| Q |
12 |
aaatgaaaatatgtttccaggatagatttttgttggcctcggcctgaagtttcgacaacggatttaatgaatttgaaacaacaattaaatgaatcgcttg |
111 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10864747 |
aaatgaaaatatgtttccaagatagatttttgttggcctcagcctgaagtttcgacaacggatttaatgaatttgaaacaacaattaaatgaatcgcttg |
10864648 |
T |
 |
| Q |
112 |
ttcactttattgaaagtttagaaaggcaactggaaagtgttcaatccaatttcttgagattgaatatgaatcgatggccattaatttcatgcattcaaat |
211 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10864647 |
ttcaatttattgaaagtttagaaaggcaactggaaagtgttcaatccaatttcttgacattgaatatgaatcgatggccattaatttcatgcattcaaag |
10864548 |
T |
 |
| Q |
212 |
ctagaggagaaatt |
225 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
10864547 |
ctagaggagaaatt |
10864534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University