View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15885_high_13 (Length: 332)
Name: NF15885_high_13
Description: NF15885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15885_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 45 - 274
Target Start/End: Complemental strand, 44104791 - 44104558
Alignment:
| Q |
45 |
ttattcttgtaaaactgagataacataactggtccagcccatacacaaatttggattgctttttccttatttctattatcactattatttttatacaatt |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44104791 |
ttattcttgtaaaactgagataacataactggtccagcccatacacaaatttggattgctttttccttatttctattatcactattatttttatacaatt |
44104692 |
T |
|
| Q |
145 |
ctttagaatatttattgacatgttagtannnnnnnnattcactgagatttgaattatgatcattggaactctcttaagactttgtttgtattgatgaa-- |
242 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44104691 |
ctttagaatatttattgacatgttagtatattttttattcactgagatttgaattatgatcattggaactctcttaagactttgtttgtattgatgaaat |
44104592 |
T |
|
| Q |
243 |
--atatgatggaatggagtggtatggaatgtggt |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44104591 |
atatatgatggaatggagtggtatggaatgtggt |
44104558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 274 - 307
Target Start/End: Complemental strand, 44104540 - 44104507
Alignment:
| Q |
274 |
tgaaaaattagtggaatagagtgatatatgatga |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
44104540 |
tgaaaaattagtggaatagagtgatatatgatga |
44104507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University