View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15885_high_18 (Length: 307)
Name: NF15885_high_18
Description: NF15885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15885_high_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 13 - 220
Target Start/End: Complemental strand, 27439932 - 27439725
Alignment:
| Q |
13 |
acagatgtgcaaaacagcaactcaattggaatcaataaaaataataggtagcagcatttgaaataaagggaattgggataaaattatgggaatgaaaatt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27439932 |
acagatgtgcaaaacagcaactcaattggaatcaataaaaataataggtagcagcatttcaaataaagggaattgggataaaattatgggaatgaaaatt |
27439833 |
T |
|
| Q |
113 |
taaaggcacggtgactttcattgaaaagaagggtatgataaagaaaactcagctttcgattccaaagaaaacatgctttagaatagaattcttatctctc |
212 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27439832 |
taaaggaacggtgactttcattgaaaataagggtatgataaagaaaactaagctttcgattccaaagaaaacatgctttagaatagaattcttatctctc |
27439733 |
T |
|
| Q |
213 |
tagtagcc |
220 |
Q |
| |
|
|||||||| |
|
|
| T |
27439732 |
tagtagcc |
27439725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University