View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15885_high_21 (Length: 268)
Name: NF15885_high_21
Description: NF15885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15885_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 35409854 - 35410092
Alignment:
| Q |
1 |
ggggtgtttagtttaggccaccaggtagcatttttatgatcagggtgccccatgttgatgaattctttgtaccaggactggagttcattgtcagaggaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35409854 |
ggggtgtttagtttaggccaccaggtagcatttttatgatcagggtgccccatgttgatgaattctttgtaccaggactggagttcattgtcagaagaaa |
35409953 |
T |
 |
| Q |
101 |
cggcatttaaatctttgtagtaatggttcacacaggtcctgaccaacttctctatactagtccatatggggagtccatcagccgcataaggataatcttc |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35409954 |
tggcattcaaatctttgtagtaatggttcacataggtcctgaccaacttctctatactagaccatatgaggagtccatcagccgcataaggataatcttc |
35410053 |
T |
 |
| Q |
201 |
agtaagtagtctaatgccatgtggctgagtggcatctgg |
239 |
Q |
| |
|
| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35410054 |
aataagtagtctaatgccatgtggccgagtggcatctgg |
35410092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University