View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15886_high_2 (Length: 401)
Name: NF15886_high_2
Description: NF15886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15886_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 4e-51; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 33829326 - 33829220
Alignment:
| Q |
1 |
aagcatatattcaacatgttaaaacatgtatttttcgagtttcatagtatttgagtcgagctttttcacgattaaaatttgaatgctaatatagttcatt |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33829326 |
aagcatatattcaacaagttaaaacatgtatttttcgagtttcatagtatttgagtcgagctttttcacgattaaaatttgaatgctaatatagttcatt |
33829227 |
T |
 |
| Q |
101 |
tcagaat |
107 |
Q |
| |
|
||||||| |
|
|
| T |
33829226 |
tcagaat |
33829220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 337 - 401
Target Start/End: Complemental strand, 33829174 - 33829109
Alignment:
| Q |
337 |
gtatatctttgataatttttcttggaggctaacacacctaacagagactata-tgatgagtggaaa |
401 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
33829174 |
gtatatctttgataattttccttggaggctaacacacctaacagagactgtattgatgagtggaaa |
33829109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University