View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15886_low_7 (Length: 224)
Name: NF15886_low_7
Description: NF15886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15886_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 20 - 206
Target Start/End: Complemental strand, 43663402 - 43663216
Alignment:
| Q |
20 |
atgctctagaattgccattttatggcttgcatgaatgactaagtaataaccagtcatttttaattgtaaagtttgatgagaggctgtatagaaatcctgt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43663402 |
atgctctagaattgccattttatggcttgcatgaatgactaagtaataaccagtcatttttaattgtaaagtttgatgagaggctgtatagaaatcctgt |
43663303 |
T |
|
| Q |
120 |
tctagcaggactcagccctttctttatttatgtgatatttggtacattttggatgctcagaagataatgtagtgatgatgatgtata |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43663302 |
tctagcaggactcagccctttctttatttatgtgatatttggtacattttggatgctcagaagataacgtagtgatgatgatgtata |
43663216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University