View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15888_low_15 (Length: 262)
Name: NF15888_low_15
Description: NF15888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15888_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 24 - 247
Target Start/End: Complemental strand, 42289056 - 42288836
Alignment:
| Q |
24 |
taacaggctcttaacaatgaactaataatatacatgggatgggaccctccnnnnnnntatatacatgagaccgtaaaagnnnnnnntaactaatatacat |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| ||||||||||| |||||||||||||| |
|
|
| T |
42289056 |
taacaggctcttaacaatgaactaataatatacatgggatgggaccctccaaaaaaatatat-catgggaccgtaaaagaaaaaaataactaatatacat |
42288958 |
T |
 |
| Q |
124 |
gggatggtcaggacattcatattgcatgaatgaataatatagagttgtgtaactaaaaaattgcatgaactatgggaataaaggtgttgaaccatagtct |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42288957 |
gggatggtcaggacattcatattgcatgaatgaataatatagagttgtgtaactaaaaaattgcatgaactatggga--aaaggtgttgaaccatagtct |
42288860 |
T |
 |
| Q |
224 |
cattatcttctttgtatctctctg |
247 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
42288859 |
cattatcttctttgtatctctctg |
42288836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University