View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15888_low_15 (Length: 262)

Name: NF15888_low_15
Description: NF15888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15888_low_15
NF15888_low_15
[»] chr5 (1 HSPs)
chr5 (24-247)||(42288836-42289056)


Alignment Details
Target: chr5 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 24 - 247
Target Start/End: Complemental strand, 42289056 - 42288836
Alignment:
24 taacaggctcttaacaatgaactaataatatacatgggatgggaccctccnnnnnnntatatacatgagaccgtaaaagnnnnnnntaactaatatacat 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||       ||||| |||| |||||||||||       ||||||||||||||    
42289056 taacaggctcttaacaatgaactaataatatacatgggatgggaccctccaaaaaaatatat-catgggaccgtaaaagaaaaaaataactaatatacat 42288958  T
124 gggatggtcaggacattcatattgcatgaatgaataatatagagttgtgtaactaaaaaattgcatgaactatgggaataaaggtgttgaaccatagtct 223  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||    
42288957 gggatggtcaggacattcatattgcatgaatgaataatatagagttgtgtaactaaaaaattgcatgaactatggga--aaaggtgttgaaccatagtct 42288860  T
224 cattatcttctttgtatctctctg 247  Q
    ||||||||||||||||||||||||    
42288859 cattatcttctttgtatctctctg 42288836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University