View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15889_high_2 (Length: 247)
Name: NF15889_high_2
Description: NF15889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15889_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 3 - 232
Target Start/End: Original strand, 23063396 - 23063618
Alignment:
| Q |
3 |
atctgttcacaagtctaatgtgtgtaaccttccttaaaacttgcgccatagcttattgcttgccgttattggtgctatagacatgaaacaatagttgaat |
102 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23063396 |
atctattcacaagtctaatgtgtgtaaccttctttaaaac----gccatagcttattgcttgccgttattggtgctatagacatgaaacaatagttgaat |
23063491 |
T |
 |
| Q |
103 |
ttctcattgtctagttttactccgctttaactaagtctgatatctgcaacacccacatattagtaaactcgnnnnnnnnttgttgacccttgttcgactg |
202 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |
|
|
| T |
23063492 |
ttctcatcgtctagttttactacgctttaactaagtctgatatctgcaacacccacatattagtaaactcgaaaaaaaattgttgacccttgttcgacgg |
23063591 |
T |
 |
| Q |
203 |
cattattattgctcatctaaccttgttctt |
232 |
Q |
| |
|
| |||||||||||||||||||||||||| |
|
|
| T |
23063592 |
c---attattgctcatctaaccttgttctt |
23063618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University