View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1588_low_7 (Length: 236)
Name: NF1588_low_7
Description: NF1588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1588_low_7 |
 |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0011 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 240444 - 240235
Alignment:
| Q |
1 |
ctcaatgataccacttttttaggttaatttctaaaacatctctataactaattacttggcatgttttgattagatgcaatataagcaagtaaaaatagtc |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
240444 |
ctcaatgataccacttttttgggttaatttctaaaatatctctataactaattacttggcatgttttgattagatgcaatataagtaagt-aaaatagtc |
240346 |
T |
 |
| Q |
101 |
acataaaatatgccacacacatacnnnnnnncacccatatcaagtcaaatacacaagcatcctctaatatccaaggaccgtccttcttcatttgatgcaa |
200 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
240345 |
acat--aatatgccacacacatacaaaaaaacacccatatcaagtcaaatacacaagcatcctctaatatccaaggaccgtccttctccatttgatgcaa |
240248 |
T |
 |
| Q |
201 |
catgattacatga |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
240247 |
catgattacatga |
240235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 3 - 41
Target Start/End: Original strand, 44599484 - 44599522
Alignment:
| Q |
3 |
caatgataccacttttttaggttaatttctaaaacatct |
41 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
44599484 |
caatgataccacttctttaggttaatttctaaaatatct |
44599522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University