View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15891_high_10 (Length: 204)
Name: NF15891_high_10
Description: NF15891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15891_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 17 - 188
Target Start/End: Original strand, 15714184 - 15714355
Alignment:
| Q |
17 |
gagaacaaatcgttagcatatgcttttcacccagagaataatgtcacagacaatgtcaagtctttgtttcaagacgcgtttaaccgttggtcaaatgcaa |
116 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15714184 |
gagaacagatcgttagcatatgcttttcatccagagaataatgtcacagacaatgttaagtctttgtttcaagacgcgtttaaccgttggtcaaatgcaa |
15714283 |
T |
 |
| Q |
117 |
ctgaattgaacttcattgagacaacgtcgtttaatgattcagatattcgtatagcgtttttaacgttggatg |
188 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15714284 |
ctgaattgaacttcattgagacaatgtcgtttaatgattcagatattcgtatagcgtttttaacgttggatg |
15714355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University