View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15891_high_3 (Length: 415)
Name: NF15891_high_3
Description: NF15891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15891_high_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 1 - 399
Target Start/End: Complemental strand, 38747940 - 38747539
Alignment:
| Q |
1 |
ccaacttcaacactttttggtatgtctcatttttcttcacctccggcatcaccacctatgtctccgatgaagccacgaaacggtgtttcatcgctttcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38747940 |
ccaacttcaacactttttggtatgtctcatttttcttcacctccggcatcaccacctatgtctccgatgaagccacgaaacggtgtttcatcgctttcac |
38747841 |
T |
|
| Q |
101 |
gctatggttcttcgattaatagtaacaatcttcgttatagagacatgcttattgatcttttgggttcttttgaagggatgaatttcaatgacggttca-- |
198 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38747840 |
gctacggttcttcaattaatagtaacaatcttcgttatagagacatgcttattgatcttttgggttcttttgaagggatgaatttcaatgacggttcatc |
38747741 |
T |
|
| Q |
199 |
-nnnnnnnnnnnnnnnnnacctgtttctgtttctgctgctaaagcacttcagatacaaaacatgggttatcttgaatctcttgatgttccagaggaacag |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38747740 |
ttctgcttcttcttcttcacctgtttctgtttctgctgctaaagcacttcagatacaaaacatgggttatcttgaatctcttgatgttccagaggaacag |
38747641 |
T |
|
| Q |
298 |
aatcagcaacagtttattgtttcaccttcttcttcttttgatcatcaacaacatttcaatattctttcacaatcaattcatcagaatttgacaccaagtt |
397 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38747640 |
aatcagcaacagtttattgtttcaccttcttcttcatttgatcatcaacaacatttcaatattctttcacaatccattcatcagaatttgacaccaagtt |
38747541 |
T |
|
| Q |
398 |
tc |
399 |
Q |
| |
|
|| |
|
|
| T |
38747540 |
tc |
38747539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University