View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15892_low_7 (Length: 324)
Name: NF15892_low_7
Description: NF15892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15892_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 5e-90; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 18 - 185
Target Start/End: Original strand, 46986478 - 46986645
Alignment:
| Q |
18 |
atgaaaaccaaaccaaaatggatatcgaaacgtggaatatataaaagtgaagatgaaaatattcattggataggggaggtatatccttatgtgaagagag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46986478 |
atgaaaaccaaaccaaaatggatatcgaaacgtggaatatataaaagtgaagatgaaaatattcattggataggggaggtatatccttatgtgaagagag |
46986577 |
T |
 |
| Q |
118 |
gaatagagtgtgtgtagttttcaatgctatcttaacttgtctgagtcagaggggagccaaagcaattt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46986578 |
gaatagagtgtgtgtagttttcaatgctatcttaacttgtctgagtcagaggggagccaaagcaattt |
46986645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 272 - 307
Target Start/End: Original strand, 46986736 - 46986771
Alignment:
| Q |
272 |
caagttcattgttggctacaaaatttggataaattt |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
46986736 |
caagttcattgttggctacaaaatttggataaattt |
46986771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University