View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15894_high_13 (Length: 316)
Name: NF15894_high_13
Description: NF15894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15894_high_13 |
 |  |
|
| [»] scaffold0248 (1 HSPs) |
 |  |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 17 - 97
Target Start/End: Original strand, 32802549 - 32802629
Alignment:
| Q |
17 |
tattcttgcttgccaaatcattgacttgatttatagtttattatgcggaaaataaacaatgagaaaaagaatgtaagtcta |
97 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32802549 |
tattcttgcttgccaaatcattggcttgatttgtagtatattatgcggaaaataaacaatgagaaaaagaatgcaagtcta |
32802629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0248 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: scaffold0248
Description:
Target: scaffold0248; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 19 - 97
Target Start/End: Original strand, 3726 - 3804
Alignment:
| Q |
19 |
ttcttgcttgccaaatcattgacttgatttatagtttattatgcggaaaataaacaatgagaaaaagaatgtaagtcta |
97 |
Q |
| |
|
||||||||||||||||||||| |||| ||| |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3726 |
ttcttgcttgccaaatcattggcttggtttgtagtatattatgcggaaaataaacaatgagaaaaagaatgtaagtcta |
3804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 19 - 97
Target Start/End: Complemental strand, 273115 - 273037
Alignment:
| Q |
19 |
ttcttgcttgccaaatcattgacttgatttatagtttattatgcggaaaataaacaatgagaaaaagaatgtaagtcta |
97 |
Q |
| |
|
||||||||||||||||||||| |||| ||| |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
273115 |
ttcttgcttgccaaatcattggcttggtttgtagtatattatgcggaaaataaacaatgagaaaaagaatgtaagtcta |
273037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 19 - 97
Target Start/End: Original strand, 1537597 - 1537675
Alignment:
| Q |
19 |
ttcttgcttgccaaatcattgacttgatttatagtttattatgcggaaaataaacaatgagaaaaagaatgtaagtcta |
97 |
Q |
| |
|
||||||||||||||||||||| |||| ||| |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1537597 |
ttcttgcttgccaaatcattggcttggtttgtagtatattatgcggaaaataaacaatgagaaaaagaatgtaagtcta |
1537675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 19 - 97
Target Start/End: Original strand, 17767644 - 17767722
Alignment:
| Q |
19 |
ttcttgcttgccaaatcattgacttgatttatagtttattatgcggaaaataaacaatgagaaaaagaatgtaagtcta |
97 |
Q |
| |
|
||||||||||||||||||||| |||| ||| |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17767644 |
ttcttgcttgccaaatcattggcttggtttgtagtatattatgcggaaaataaacaatgagaaaaagaatgtaagtcta |
17767722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 47 - 97
Target Start/End: Original strand, 37392189 - 37392239
Alignment:
| Q |
47 |
ttatagtttattatgcggaaaataaacaatgagaaaaagaatgtaagtcta |
97 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
37392189 |
ttatagtttattatgcgaaaaataaacaatgagaaaaaggatgtaagtcta |
37392239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 17 - 55
Target Start/End: Original strand, 37391977 - 37392015
Alignment:
| Q |
17 |
tattcttgcttgccaaatcattgacttgatttatagttt |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37391977 |
tattcttgcttgccaaatcattgacttgatttatagttt |
37392015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University