View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15894_high_15 (Length: 305)
Name: NF15894_high_15
Description: NF15894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15894_high_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 7e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 66 - 288
Target Start/End: Complemental strand, 48116465 - 48116245
Alignment:
| Q |
66 |
ataattgacagataaaggagcgtatatatttaatggatgaaataaagttatannnnnnnnagttcgcaccccaaccatct-agagtggctccagaacaag |
164 |
Q |
| |
|
||||| |||| |||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
48116465 |
ataatggacaaataaaggagc--atatatttaatggatgaaataaagttatattttttt-agttcgcaccccagccatcttagagtggctccagaacaaa |
48116369 |
T |
|
| Q |
165 |
taattgtctcatacatatgatttacaattcaaattgaataagttgtcaaaatacaaggatatttctctacaaaatctgctgagattttccctcaaattat |
264 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48116368 |
taattgtctcatacacatgatttacaattcaaattgaataagttgtcaaaatacaaggatatttctctacaaaatctgctgagattttccctcaaattat |
48116269 |
T |
|
| Q |
265 |
gcaaagttggtagatgatgccagt |
288 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
48116268 |
gcaaagttggtagatgatgccagt |
48116245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 9 - 55
Target Start/End: Complemental strand, 48116601 - 48116555
Alignment:
| Q |
9 |
gaagaatatcatactgaattaatatgtatggcatacacaacttgaac |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48116601 |
gaagaatatcatactgaattaatatgtatggcatacacaacttgaac |
48116555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University