View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15894_high_22 (Length: 241)
Name: NF15894_high_22
Description: NF15894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15894_high_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 19 - 225
Target Start/End: Complemental strand, 32182417 - 32182214
Alignment:
| Q |
19 |
aatatatctttaaatgaaaaggattttaactatgtctccctggcaagttgtgtgtgtgacaatcgactattctggtgaaaaatggatggttcaccttaca |
118 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32182417 |
aatatatctttaaatggaaaggattttaattatgtctcca---caagttgtgtgtgtgacaatcgactattctagtgaaaaatggatggttcaccttaca |
32182321 |
T |
 |
| Q |
119 |
ttaacctcattgtgaactaaaaggtgatgtcacataaaagtaacacagtagagttgtggtgacgaaacaaaattctttagtattttgaaatttaaccgag |
218 |
Q |
| |
|
||||| ||||||||||| |||||||| | ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
32182320 |
ttaacttcattgtgaaccaaaaggtggcgccacataagagtaacacagtagagttgtggtgacgaaacaaaattctttagtattttgaagtttgaccgag |
32182221 |
T |
 |
| Q |
219 |
tattcat |
225 |
Q |
| |
|
||||||| |
|
|
| T |
32182220 |
tattcat |
32182214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University