View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15894_high_25 (Length: 225)
Name: NF15894_high_25
Description: NF15894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15894_high_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 11 - 209
Target Start/End: Original strand, 43206096 - 43206294
Alignment:
| Q |
11 |
tagattattctttatcctctaatgaatgaaagtattcaccttcaaatcctgaaaataaatagtttttgttattaacatataacacaaacaatggttggct |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43206096 |
tagatttttctttatcctctaatgaatgaaagtattcaccttcaaatcctgaaaataaatagtttttgttattaacatataacacaaacaatggttggct |
43206195 |
T |
 |
| Q |
111 |
gcatctgcatgcaatccatataaactaacaatggttcaaatattatatattatgtataccttctagataatttgctagtttttctatgttggaagctac |
209 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43206196 |
gcatctgcatgcaatccatattaactaacaatggttcaaatattatatattatgtataccttctagataatttgctagtttttctatgttggaagctac |
43206294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University