View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15894_high_6 (Length: 420)
Name: NF15894_high_6
Description: NF15894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15894_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 378; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 378; E-Value: 0
Query Start/End: Original strand, 1 - 405
Target Start/End: Original strand, 42935446 - 42935853
Alignment:
| Q |
1 |
tagcagcagaggaaattaggtgaagcttgatattctccagctgcatctccagctgcaagttcttcttcttctcattttccaattctgtcctcaacttaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42935446 |
tagcagcagaggaaattaggtgaagcttgatattctccagctgcatctccagctgcaagttcttcttcttctcattttccaattctgtcctcaacttaga |
42935545 |
T |
 |
| Q |
101 |
gatctcttgcaccattttctcatcactttcagccacatgaatctcctctccaccaattagattcattagaaacttaacttgtcccaactcttgttccaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42935546 |
gatctcttgcaccattttctcatcactttcagccacatgaatctcctctccaccaattagattcattagaaacttaacttgtcccaactcttgttccaag |
42935645 |
T |
 |
| Q |
201 |
ctctctttcaacacattcaacgttgccaacgtagcttcgcggttcttaacaacaccaccaacattttcatgatca---acatcagtagtattggtctttg |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
42935646 |
ctctctttcaacacattcaacgttgccaacgtagcttcacggttcttaacaacaccaccgacattttcatgatcaaccacatcagaagtattggtctttg |
42935745 |
T |
 |
| Q |
298 |
gctccatcacagttcctgatgctgtaacaacatcatcctcttggatcactttttcttcttcgaaccgaacttgtttcacaacttcatcatctttgctttg |
397 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42935746 |
gctccatcacagttcctgatgctgtaacaacagcatcctcttggatcactttttcttcttcgaaccgaacttgtttcacaacttcatcatctttgctttg |
42935845 |
T |
 |
| Q |
398 |
atcctttg |
405 |
Q |
| |
|
|||||||| |
|
|
| T |
42935846 |
atcctttg |
42935853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University