View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15894_high_8 (Length: 356)
Name: NF15894_high_8
Description: NF15894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15894_high_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 6e-93; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 6e-93
Query Start/End: Original strand, 18 - 190
Target Start/End: Original strand, 30761839 - 30762011
Alignment:
| Q |
18 |
ggaaagatcttgtgttagttctccagccacataccttctatcttttggtaactcaagtattgaaccaatcattgaaccaatgtcacataaaactaaaaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30761839 |
ggaaagatcttgtgttagttctccagccacataccttctatcttttggtaactcaagtattgaaccaatcattgaaccaatgtcacataaaactaaaaga |
30761938 |
T |
|
| Q |
118 |
aggacagatgaatcaaggggggtgaaggaagcaacaaagaaggttagaagatcatgtgagacagtacaagatc |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30761939 |
aggacagatgaatcaaggggggtgaaggaagcaacaaagaaggttagaagatcatgtgagacagtacaagatc |
30762011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 187 - 339
Target Start/End: Complemental strand, 30761991 - 30761839
Alignment:
| Q |
187 |
gatcttctaaccttctttgttgcttccttcaccccccttgattcatctgtccttcttttagttttatgtgacattggttcaatgattggttcaatacttg |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30761991 |
gatcttctaaccttctttgttgcttccttcaccccccttgattcatctgtccttcttttagttttatgtgacattggttcaatgattggttcaatacttg |
30761892 |
T |
|
| Q |
287 |
agttaccaaaagatagaaggtatgtggctggagaactaacacaagatctttcc |
339 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30761891 |
agttaccaaaagatagaaggtatgtggctggagaactaacacaagatctttcc |
30761839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University