View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15894_low_24 (Length: 235)
Name: NF15894_low_24
Description: NF15894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15894_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 81 - 220
Target Start/End: Original strand, 44752460 - 44752603
Alignment:
| Q |
81 |
tactcatgtaatgatataaacagtcgtgatgcaattg----tataaatttctaagaacctg-tatttgggtttgagagtccacaagctaaggccttcaaa |
175 |
Q |
| |
|
||||||||| |||| | | ||||| |||||||||||| |||| ||||||||||||||| ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
44752460 |
tactcatgtgatgaaaaatacagttgtgatgcaattgcatatatagatttctaagaacctggtatttggatta-agagtccacaagctaaggccttcaaa |
44752558 |
T |
|
| Q |
176 |
ggaatgaccaatgatagaagaaacaggaacagacatcctttgatc |
220 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44752559 |
ggagtgaccaatgatagaagaaacaggaacagacatcctttgatc |
44752603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University