View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15895_high_44 (Length: 280)
Name: NF15895_high_44
Description: NF15895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15895_high_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 251; Significance: 1e-139; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 47416909 - 47416647
Alignment:
| Q |
1 |
taaagaagctatgtcctatactgatgtcgtaactagaaatgccagttctaataaccaactcaactactggatattaatattaatcacatcgatacagcag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
47416909 |
taaagaagctatgtcctatactgatgtcgtaactagaaatgccagttctaataaccaactcaactactggatattaatattaatcacgtcgatacagcag |
47416810 |
T |
 |
| Q |
101 |
gatcttcaggttggtctcttaaggcatgtaagaaattacatataacctttagactttgtttgggtgttaggagaggagggaatgagaggggaagccccac |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47416809 |
gatcttcaggttggtctcttacggcatgtaagaaattacatataacctttagactttgttcgggtgttaggagaggagggaatgagaggggaagccccac |
47416710 |
T |
 |
| Q |
201 |
cttgtttgagagtgtttttggaggggaggagagggacttatgactaatattttctttgctgag |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47416709 |
cttgtttgagagtgtttttggaggggaggagagggacttatgactaatattttctttgctgag |
47416647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 4803161 - 4803233
Alignment:
| Q |
1 |
taaagaagctatgtcctatactgatgtcgtaactagaaatgccagttctaataaccaactcaactactggata |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
4803161 |
taaagaagctatgtcctatactgatgtcgtaactagaaatgccagttctaataacaaacttaactactggata |
4803233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University