View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15895_low_16 (Length: 422)
Name: NF15895_low_16
Description: NF15895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15895_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 260; Significance: 1e-145; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 11 - 286
Target Start/End: Original strand, 40011666 - 40011941
Alignment:
| Q |
11 |
gagcacagaggagacaaacttaagagggagagtttgattgagttgaaggaaatgtttcgtgagagaaaaatggatgaattgaaatgggtttttgaggatg |
110 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40011666 |
gagcacagaggagagaaacttaagagggagagtttgattgagttgaaggaaatgtttcgtgagagaaaaatggatgaattgaaatgggtttttgaggatg |
40011765 |
T |
 |
| Q |
111 |
atattgaaattaacgaggtttggttcgatgaaaataacaatgggaaaaggaaaaagacgagtaagcgaagtgaggttcaggttgtgaggtttcttgttga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40011766 |
atattgaaattaacgaggtttggttcgatgaaaataacaatgggaaaaggaaaaagacgagtaagcgaagtgaggttcaggttgtgaggtttcttgttga |
40011865 |
T |
 |
| Q |
211 |
taggtttgcgttctgtttttcatttgctgtcaattcttttgggagttagttagtatgcattgctggtgtaaaatta |
286 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
40011866 |
taggtttgtgttctgtttttcatttgctgtcaattcttttgggagttagttagaatgcattgttggtgtaaaatta |
40011941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 341 - 403
Target Start/End: Original strand, 40012141 - 40012203
Alignment:
| Q |
341 |
gtaggttgtgtgataaggaaattggggctaaggattggaaattttcgaggttgatgaagctgt |
403 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40012141 |
gtaggttgtgtgataaggaaattagggctaaggattggaaattttcgaggttgatgaagctgt |
40012203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University