View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15895_low_21 (Length: 393)
Name: NF15895_low_21
Description: NF15895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15895_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 66 - 375
Target Start/End: Complemental strand, 52154599 - 52154290
Alignment:
| Q |
66 |
atacgtaggatctactttgtactatgcctgcccaaatagatgtggtgtagaggtcacatgtgatgaaaaaactatttgttctcggtgcaacatagctatg |
165 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52154599 |
atacataggatctactttgtactatgcctgcccaaatagatgtggtgtagaggtcacatgtgatgaaaaaactatttgttctcggtgcaacatagctatg |
52154500 |
T |
 |
| Q |
166 |
aaccgccattcacattttgagcttaagacaaaggatgttgaagaaaacatcttgattaagaatgggttcgtgaaagatgatgtaactttcttggtgatgg |
265 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52154499 |
aaccgccgttcacattttgagcttaagacaaaggatgttgaagaaaacatcttgattaagaatgggttcgtgaaagatgatgtaactttcttggtgatgg |
52154400 |
T |
 |
| Q |
266 |
atgatttagttattcaacccttgagttcagctatatcaatggtttctttacttagaaacaagtttaatatcaacgagattggtgtcttgcaagaaatggt |
365 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52154399 |
atgatttagttattcaacccttgagttcagctatatcaatggtttctttacttagaaacaagtttaatatcaacgagattggtgtcttgcaagaaatggt |
52154300 |
T |
 |
| Q |
366 |
ggttgaattg |
375 |
Q |
| |
|
|||||||||| |
|
|
| T |
52154299 |
ggttgaattg |
52154290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University