View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15895_low_26 (Length: 367)
Name: NF15895_low_26
Description: NF15895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15895_low_26 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 15 - 367
Target Start/End: Original strand, 14527273 - 14527626
Alignment:
| Q |
15 |
aaggaggcagtgttaa-gagcggttcgagatgcaccgaaaaataaaggctatgccagagggaaagtagttgtatcaggaacatcgaatgaatctgcttat |
113 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14527273 |
aaggaggcagtgttaaagagcggttcgagatgcaccgaaaaataaaggctatgccagagggaaagtagttgtatcaggaacatcgaatgaatctgcttat |
14527372 |
T |
 |
| Q |
114 |
gttctggctgattgttagagaagtttggattctaagtcttgcaaagcatgtctcgagcatgcatcatcttctattttgagatgtctgccctcgtcagaag |
213 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14527373 |
gttctggctgattgttggagaagtttggattctaagtcttgcaaagcatgtctcgagcatgcgtcatcttctattttgagatgtctgccctcgtcagaag |
14527472 |
T |
 |
| Q |
214 |
gacgggcgctcaacaccggatgcttcatgaggtactccaacactgactttcttaacaaggaagttgaaaatgggagttcaggaggtaaataaattgtagt |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14527473 |
gacgggcgctcaacaccggatgcttcatgaggtactccaacactgactttcttaacaaggaagttgaaaatgggagttcaggaggtaaataaattgtagt |
14527572 |
T |
 |
| Q |
314 |
tctcggcactttttagtggacaaaattatgctaggatgtaggttcatgcattga |
367 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14527573 |
tctcggcactttttagtggacaaaattatgctaggatgtagcttcatgcattga |
14527626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University