View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15895_low_41 (Length: 303)
Name: NF15895_low_41
Description: NF15895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15895_low_41 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 32 - 286
Target Start/End: Complemental strand, 26283370 - 26283115
Alignment:
| Q |
32 |
aaacacaagttcaaatcccgacgaagaagaaaattactaaaataatatctaaatttatttaacaacattcaacatattagggttt-acctgaacgaaccg |
130 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26283370 |
aaacacaagttcaattcccgatgaagaagaaaattactaaaataataactaaatttatttaacaacattcaacatattagggttttacctgaacgaaccg |
26283271 |
T |
|
| Q |
131 |
cgatcgactttgtcccaaaccatggaatgatcagcagcattagtgttcactttatcccaatgcaaaggcttcaatttcacttgatcattgttggattctt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26283270 |
cgatcgactttgtcccaaaccatggaatgatcagcagcattagtgttcactttatcccaatgcaaaggcttcaatttcacttgatcattgttggattctt |
26283171 |
T |
|
| Q |
231 |
gcatcttacctttccctgaagagtttctttgattgctttgaggaatagcttttgat |
286 |
Q |
| |
|
||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26283170 |
gcatcatgcctttccctgaagagtttctttgattgctttgaggaatagcttttgat |
26283115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 115 - 212
Target Start/End: Complemental strand, 15944916 - 15944822
Alignment:
| Q |
115 |
ttacctgaacgaaccgcgatcgactttgtcccaaaccatggaatgatcagcagcattagtgttcactttatcccaatgcaaaggcttcaatttcactt |
212 |
Q |
| |
|
|||||| || |||||||| |||| ||||||||| |||||||| |||||| || |||||| ||||| |||||||||||||| || |||||||| |||| |
|
|
| T |
15944916 |
ttacctaaaagaaccgcggtcgattttgtcccacaccatggagtgatca--ag-attagtattcaccttatcccaatgcaatggtttcaattttactt |
15944822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University