View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15895_low_42 (Length: 302)
Name: NF15895_low_42
Description: NF15895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15895_low_42 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 17 - 278
Target Start/End: Complemental strand, 46913645 - 46913384
Alignment:
| Q |
17 |
agtaacatcaaccacttgttgttgagattgaatcatttcctgcatagaacggaggaaatcaacgtaagggtttacagaatattttggcaccctcttcaca |
116 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46913645 |
agtaacatccaccacttgttgttgagattgaatcatttcctgcatagaacggaggaaatcaacgtaagggtttacagaatattttggcaccctcttcaca |
46913546 |
T |
|
| Q |
117 |
ctacctcctcttggtatcaacgagttattacagggtagagtgtcgttggagggagactctgtgatggaattggagctgcctggggaggagaagaagaacc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46913545 |
ctacctcctcttggtatcaacgagttattacagggtagagtgtcgttggagggagactctgtgatggaattggagctgcctggggaggagaagaagaacc |
46913446 |
T |
|
| Q |
217 |
gttgggaggcgaagacggaagaaaagtcaggtggtggaagctccgtggtgtcgtagaaatag |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46913445 |
gttgggaggcgaagacggaagaaaagtcaggtggtggaagctccgtggtgtcgtagaaatag |
46913384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University