View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15895_low_44 (Length: 285)
Name: NF15895_low_44
Description: NF15895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15895_low_44 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 16 - 266
Target Start/End: Original strand, 21461252 - 21461502
Alignment:
| Q |
16 |
atgaatgaaaaaggtgttaaggctagtttggttacttataattgtttgattcaaggggtttgtagcattggtgaatggaaaaaagcgtattttttgttga |
115 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21461252 |
atgaatgaaaaaggtgttaagggtagtttggttacttataattgtttgattcaaggggtttgtagcattggtgaatggaaaaaagcgtattttttgttga |
21461351 |
T |
|
| Q |
116 |
atgagatgatggagaagggtgtaatgcctgatgttcaaacttttacgattttggtggatggtttttgtaaagaagggttgattttggaggctaaaagtgt |
215 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21461352 |
atgagatgatggaaaagggcgtaatgcctgatgttcaaacttttacgattttggtggatggtttttgtaaagaagggttgattttggaggctaaaagtgt |
21461451 |
T |
|
| Q |
216 |
gattggttttatggtgcaaatgggtgtggaaccgaatgttgtgacttataa |
266 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
21461452 |
gattagttttatggtgcaaatgggtgtggaacctaatgttgtgacttataa |
21461502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University