View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15895_low_45 (Length: 285)
Name: NF15895_low_45
Description: NF15895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15895_low_45 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 7e-89; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 95 - 272
Target Start/End: Complemental strand, 44952647 - 44952470
Alignment:
| Q |
95 |
atttacatatttgaagtaaagtatcatctgtatgaaaatgtatgtgcgtcgagtcgtgtccaagtgagacgttatctaatctcgagcatgttataacact |
194 |
Q |
| |
|
||||||||||||||||||||||||||||| | | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44952647 |
atttacatatttgaagtaaagtatcatctttgtcaaaatgtatgtgcgtcgagtcgtgtccaagtgagacgttatctaatctcgagcatgttataacact |
44952548 |
T |
|
| Q |
195 |
atacatatattagaatagtctaggcctacgaggggcgcaagacccgtgttaggaccaatgaacaaagtgaagtatgtg |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44952547 |
atacatatattagaatagtctaggcctacgaggggcgcaagacccgtgttaggaccaatgaacaaagtgaagtatgtg |
44952470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 10 - 103
Target Start/End: Complemental strand, 44953472 - 44953379
Alignment:
| Q |
10 |
attattctaaattaaagtctgtgattgtttagctttctaagtgaatatgtgactatattatgttgatgtgaattatttaagtgtaatttacata |
103 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44953472 |
attattctaaattaaagtatgtgattgtttagctttctaagtgaatatgtgactatattatgttgatgtgaattctttaagtgtaatttacata |
44953379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University